WelcomeUser Guide
ToSPrivacyCanary
DonateBugsLicense

©2026 Poal.co

569

Friend of Zero Hedge and Cornell Professor Dave Collum appeared on the Quoth the Raven podcast this week and offered his unfiltered (and often profane) 2 hour long take not only on the development of the Delta variant hysteria, but also on Dr. Fauci, vaccinations and the state of lockdowns across the globe.

Collum is the Betty R. Miller Professor of Chemistry and Chemical Biology at Cornell University and holds a PhD, Columbia University, MS, Columbia University, MA, Columbia University and BS, Cornell University.

The duo of Collum and podcast host Chris Irons first talked about Dr. Anthony Fauci, the director of the U.S. National Institute of Allergy and Infectious Diseases (NIAID) and the chief medical advisor to the president, whom Collum referred to as a "pathological liar".

When asked about the FOIA request for Fauci's emails, Collum responded: "They were heavily redacted. One could only imagine what the redaction was. I got the feeling, reading the emails, Fauci was smart enough to know to not, himself, say anything. So Fauci didn't say incriminating things, it was emails to Fauci that were incriminating."

Collum also took exception with the state of the country locking down again. "This is where it just keeps getting darker," he said. "It started out as 'flatten the curve' and that made total sense...at the time it seemed like the scramble was to try and understand it, which I gave credit for them. It was really garbled because everything was 'Anti-Trump' at the time...but where I went off the rails is that it was looking like the pandemic was starting to subside and they weren't stopping."

He continued: "So now what I see, what is confounding to me, which takes me down really dark places. I see panic. Panic, authoritarian levels that we vaccinate. And it's Soviet style propaganda, it's coercion, it's bludgeoning."

Collum and Irons then discussed the lab leak theory, which Irons had ruminated about in-depth during a previous podcast days earlier. https://quoththeraven.podbean.com/e/quoth-the-raven-259-question-the-answers/

"I'd call it a crime against humanity," Collum said while talking about on the possibility of a lab leak cover-up.

"It's interesting to look back now know what we know about Fauci's communication," host Chris Irons says. "It does look like a cover-up. What else are we going to find out? It's been 18 months and the idea of a lab leak has gone from 'completely batshit conspiracy theory' to 'this is the most common sense explanation'."

"It's not just that," Collum responds. "Serious biochemists have looked at the sequencing and said 'that does not make sense'."

"There's no ethical guidelines for some of the egomaniacs in science," Collum said.

The discussion then moves on to vaccines, where Collum is quick to point out non-sequiturs in the "official" narrative: "It's incoherent because they're saying if you get vaccinated you'll be protected and then they're saying the people who are not vaccinated are risking the other people who are vaccinated and I'm like 'which is it?'"

"To vaccinate kids is nuts," he says. "And you know what else is psychotic? The moment where it crossed the dotted line was December 2020. The vaccine had been out for a very brief period. The CDC Tweeted, I can recite it almost verbatim, although there are no studies, there's no reason pregnant women shouldn't get the vaccine."

He continued, exasperated: "You're telling these women who are told don't even drink a fucking glass of wine' to get a god damn MRNA vaccine even though there's no studies?"

"That showed you the sociopathy of the campaign," Collum concludes.

You can listen to the entire interview here: https://quoththeraven.podbean.com/e/quoth-the-raven-260-dave-collum/

Friend of Zero Hedge and Cornell Professor Dave Collum appeared on the Quoth the Raven podcast this week and offered his unfiltered (and often profane) 2 hour long take not only on the development of the Delta variant hysteria, but also on Dr. Fauci, vaccinations and the state of lockdowns across the globe. Collum is the Betty R. Miller Professor of Chemistry and Chemical Biology at Cornell University and holds a PhD, Columbia University, MS, Columbia University, MA, Columbia University and BS, Cornell University. The duo of Collum and podcast host Chris Irons first talked about Dr. Anthony Fauci, the director of the U.S. National Institute of Allergy and Infectious Diseases (NIAID) and the chief medical advisor to the president, whom Collum referred to as a "pathological liar". When asked about the FOIA request for Fauci's emails, Collum responded: "They were heavily redacted. One could only imagine what the redaction was. I got the feeling, reading the emails, Fauci was smart enough to know to not, himself, say anything. So Fauci didn't say incriminating things, it was emails to Fauci that were incriminating." Collum also took exception with the state of the country locking down again. "This is where it just keeps getting darker," he said. "It started out as 'flatten the curve' and that made total sense...at the time it seemed like the scramble was to try and understand it, which I gave credit for them. It was really garbled because everything was 'Anti-Trump' at the time...but where I went off the rails is that it was looking like the pandemic was starting to subside and they weren't stopping." He continued: "So now what I see, what is confounding to me, which takes me down really dark places. I see panic. Panic, authoritarian levels that we vaccinate. And it's Soviet style propaganda, it's coercion, it's bludgeoning." Collum and Irons then discussed the lab leak theory, which Irons had ruminated about in-depth during a previous podcast days earlier. https://quoththeraven.podbean.com/e/quoth-the-raven-259-question-the-answers/ "I'd call it a crime against humanity," Collum said while talking about on the possibility of a lab leak cover-up. "It's interesting to look back now know what we know about Fauci's communication," host Chris Irons says. "It does look like a cover-up. What else are we going to find out? It's been 18 months and the idea of a lab leak has gone from 'completely batshit conspiracy theory' to 'this is the most common sense explanation'." "It's not just that," Collum responds. "Serious biochemists have looked at the sequencing and said 'that does not make sense'." "There's no ethical guidelines for some of the egomaniacs in science," Collum said. The discussion then moves on to vaccines, where Collum is quick to point out non-sequiturs in the "official" narrative: "It's incoherent because they're saying if you get vaccinated you'll be protected and then they're saying the people who are not vaccinated are risking the other people who are vaccinated and I'm like 'which is it?'" "To vaccinate kids is nuts," he says. "And you know what else is psychotic? The moment where it crossed the dotted line was December 2020. The vaccine had been out for a very brief period. The CDC Tweeted, I can recite it almost verbatim, although there are no studies, there's no reason pregnant women shouldn't get the vaccine." He continued, exasperated: "You're telling these women who are told don't even drink a fucking glass of wine' to get a god damn MRNA vaccine even though there's no studies?" "That showed you the sociopathy of the campaign," Collum concludes. You can listen to the entire interview here: https://quoththeraven.podbean.com/e/quoth-the-raven-260-dave-collum/

(post is archived)

[–] 0 pt

Criminal liar. Covid can not be Proven. The PCR 'Test' is NOW an admitted Lie. The CDC called all Flu deaths Covid. The 'mask' has a Warning on the box that it does NOT protect against Covid OR any virus. How can anyone be so stupid as to ignore these facts?

[–] 1 pt (edited )

>Covid can not be Proven. The PCR 'Test' is NOW an admitted Lie.

https://www.pasteur.fr/en/home/press-area/press-documents/operation-and-reliability-rt-pcr-tests-detection-sars-cov-2

What is an RT-PCR test? RT-PCR tests used to detect pathogens, including the test developed by the National Reference Center for Respiratory Viruses at the Institut Pasteur to detect the SARS-CoV-2 genome, are based on the polymerase chain reaction (PCR).

In this method, a small target sequence of nucleic acids (a DNA fragment) is copied multiple times, which facilitates its detection. When this amplification is detected (using a fluorophore-labeled probe), the test is said to be positive.

The short sequence of nucleic acids corresponds to a minute part of the genome of an organism or microorganism. The aim of a PCR test is to detect this sequence so that it can be confirmed whether the sample contains any DNA/RNA of the organism or microorganism. In detection tests aimed at confirming or ruling out infection with a virus or bacteria, the presence of nucleic acids from the pathogen indicates that the subject is infected.

The CNR has developed two RT-PCR tests, known respectively as IP2 and IP4, for the COVID-19 epidemic. These tests each use three separate sequences from the SARS-CoV-2 genome: two "primer" sequences to amplify a short sequence of the viral genome, and a "probe" sequence, which enables detection of the virus by binding to the sequences that have been amplified by the two primers. The genetic material in the sample must correspond with all three sequences simultaneously for the result to be positive. If one of the sequences does not bind, no signal is detected and the result is negative.

The three sequences used in the IP2 test are:

  • CTCCCTTTGTTGTGTTGT and ATGAGCTTAGTCCTGTTG, which have 18 and 17 nucleotides respectively (these are the two primer sequences)
  • and the sequence AGATGTCTTGTGCTGCCGGTA [5']Hex [3']BHQ-1, which has 21 nucleotides (this is the probe sequence).

The whole genome of SARS-CoV-2 consists of a chain of 30,000 base pairs (the human genome has 3 billion base pairs). Since genetic code has just four bases (A, T, C and G), some small nucleotide sequences can be found in several different organisms. This is the case for the sequence CTCCCTTTGTTGTGTTGT, for example, which is found in the genome of humans and also other animal species such as Labrador Retrievers, cats and pigs.

But the association of the three sequences is unique to SARS-CoV-2, and it is this which enables the virus to be identified in tests.

Reliability of the RT-PCR test To guarantee the performance of the test under development, scientists employed a system able to detect whether the three sequences used to recognize SARS-CoV-2 were present in other living organisms. With regard to the RT-PCR tests developed by the National Reference Center, the three sequences are not present simultaneously in any other organisms apart from SARS-CoV-2.

The test is then validated on primary samples (confirmed as positive and negative) to verify its specificity and sensitivity (no false positives or false negatives). Negative controls (here for example nose or throat samples taken before 2019) can help assess the risk of non-specific amplification.

Finally, it is advisable to use two different tests (the two tests developed by the CNR at the Institut Pasteur are named IP2 and IP4) on the same sample to guarantee the reliability of the result. This means that six sequences of the viral genome, rather than three, need to be recognized and amplified, thereby increasing the reliability of RT-PCR testing.