Nope. There is one reference genome. One. Provided by Wuhan. No one else has been able to sequence a SARS COV 2 genome. Why? Because they digitally mocked up a chimera in order to trigger as many false positives as possible. WTF do I mean? When you need to sequence a genome, you have to blow apart many cells many times and reverse engineer the correct order. The way to do this is to line up the first for or 5 nucleotides. So, say you have a 24 nucleotide sequence; they are only looking at the first and last 5 nucleotides to make a match. Let's say you get some of your thousands and thousands of pieces isolated. They will look like this... 1. *CAGU*AGCUAGAUACGAUAGCAUUAGC 2. **ACGU**ACGUACGUACGUACGUGAUC 3. ACGUGAUCGAUCGAUCGAUC**ACGU** 4. GAUCGAUCGAUCGAUCGAUC*CAGU* Your reference genome is going to be thousands of characters. I won't bother demonstrating. You can see how 1 and 4 have ends that overlap and, with enough data, enough cells and cell fragments, we can reliably figure out the right order. With too little data, we can say anything we want. But imagine if some digitally mocked up a genome made up of as many pairings as possible to allow for the highest statistical probability of showing positive. The genome sequencing, if you were to ask for it, would result in them exp,doing a sample of your infected cells, then subtract out everything they don't want to see... influenza, rhinovirus... whatever. So, even if you have these things, they are eliminated because the sequencer is using the reference genome provided by Wuhan and subtracting all potentially irrelevant data. The sequencing only looks for segments that match the reference genome. The BLAST database houses all this data. You can go check for yourself. While the CDC touts 280k samples have been sequenced, the longest chain I found (after looking through them one by one for a couple of hours) was a 14 nucleotide chain. Most of the submissions were from 30 to 40 random segments of merely small pairs. This data is so f***ing fake. You can purportedly order SARS COV 2 for laboratory testing. I have yet to see anyone sequence a full genome beyond what Wuhan provided, but they are clinging to this shit like saran wrap. Further proof exists in the bullshit testing. Antigen, antibody and PCR tests all show as positive for every coronavirus strain. Surprise... all human affecting coronaviruses have the S spike protein and the body responds to its presence by adding a CR3022 protein into the polyproteij chain that makes up white blood cells. CR3022 blocks S spike protein from attaching to your cells. Why make an RNA vaccine when inactive S spikes (like every other previous vaccine and like the vaccines China made for their people) will cause the body to make CR3022? Think about that. We can make a vaccine that is simple, old fashioned and causes the same result. Why in the fuck do we need to inject RNA when the Chinese already had a vaccine ready without it, when everyone already knew about S spike proteins and CR3022? How is it that two totally different types of vaccines were ready to go? How is it that, all over the world, Russia, America, China and many others miraculously found the cure immediately and at almost exactly the same time?