WelcomeUser Guide
ToSPrivacyCanary
DonateBugsLicense

©2026 Poal.co

286
https://files.catbox.moe/lgsrhb.png

(post is archived)

[–] 3 pts (edited )

What exactly do these tests test for again? Viral fragments?

Yeah pretty much. As I understand it, pasteur institute does a "double triangulation" essentially with RT-PCR tests (real time PCR), to avoid false positive results. So my guess is that if you're just doing a PCR test, your chances to get a false positive are like 100%, otherwise they wouldn't bother with that double "triple layered" approach

https://www.pasteur.fr/en/home/press-area/press-documents/operation-and-reliability-rt-pcr-tests-detection-sars-cov-2

What is an RT-PCR test? RT-PCR tests used to detect pathogens, including the test developed by the National Reference Center for Respiratory Viruses at the Institut Pasteur to detect the SARS-CoV-2 genome, are based on the polymerase chain reaction (PCR).

In this method, a small target sequence of nucleic acids (a DNA fragment) is copied multiple times, which facilitates its detection. When this amplification is detected (using a fluorophore-labeled probe), the test is said to be positive.

The short sequence of nucleic acids corresponds to a minute part of the genome of an organism or microorganism. The aim of a PCR test is to detect this sequence so that it can be confirmed whether the sample contains any DNA/RNA of the organism or microorganism. In detection tests aimed at confirming or ruling out infection with a virus or bacteria, the presence of nucleic acids from the pathogen indicates that the subject is infected.

The CNR has developed two RT-PCR tests, known respectively as IP2 and IP4, for the COVID-19 epidemic. These tests each use three separate sequences from the SARS-CoV-2 genome: two "primer" sequences to amplify a short sequence of the viral genome, and a "probe" sequence, which enables detection of the virus by binding to the sequences that have been amplified by the two primers. The genetic material in the sample must correspond with all three sequences simultaneously for the result to be positive. If one of the sequences does not bind, no signal is detected and the result is negative.

The three sequences used in the IP2 test are:

  • CTCCCTTTGTTGTGTTGT and ATGAGCTTAGTCCTGTTG, which have 18 and 17 nucleotides respectively (these are the two primer sequences)
  • and the sequence AGATGTCTTGTGCTGCCGGTA [5']Hex [3']BHQ-1, which has 21 nucleotides (this is the probe sequence).

The whole genome of SARS-CoV-2 consists of a chain of 30,000 base pairs (the human genome has 3 billion base pairs). Since genetic code has just four bases (A, T, C and G), some small nucleotide sequences can be found in several different organisms. This is the case for the sequence CTCCCTTTGTTGTGTTGT, for example, which is found in the genome of humans and also other animal species such as Labrador Retrievers, cats and pigs.

But the association of the three sequences is unique to SARS-CoV-2, and it is this which enables the virus to be identified in tests.

Reliability of the RT-PCR test To guarantee the performance of the test under development, scientists employed a system able to detect whether the three sequences used to recognize SARS-CoV-2 were present in other living organisms. With regard to the RT-PCR tests developed by the National Reference Center, the three sequences are not present simultaneously in any other organisms apart from SARS-CoV-2.

The test is then validated on primary samples (confirmed as positive and negative) to verify its specificity and sensitivity (no false positives or false negatives). Negative controls (here for example nose or throat samples taken before 2019) can help assess the risk of non-specific amplification.

Finally, it is advisable to use two different tests (the two tests developed by the CNR at the Institut Pasteur are named IP2 and IP4) on the same sample to guarantee the reliability of the result. This means that six sequences of the viral genome, rather than three, need to be recognized and amplified, thereby increasing the reliability of RT-PCR testing.

[–] 1 pt

Sounds like a pretty definitive response, despite that the virus itself has never actually been isolated. Nice copypasta.

[–] 2 pts (edited )

Well it certainly doesn't prove the virus exists, it just shows at this point that a mere PCR test is totally insufficient

despite that the virus itself has never actually been isolated.

No, sars-cov-2 (2019-nCov) has been isolated, and its genome has been sequenced. But when given the actual data you'll just dismiss it and label it as "not a proof!" without further technical demonstration, because that's just way above your level of scientific knowledge

https://pic8.co/sh/kKRrOC.jpeg

https://www.pasteur.fr/en/press-area/press-documents/institut-pasteur-sequences-whole-genome-coronavirus-2019-ncov

[–] 0 pt

" With regard to the RT-PCR tests developed by the National Reference Center, the three sequences are not present simultaneously in any other organisms apart from SARS-CoV-2"

How would they confirm this?

[–] 0 pt

What's a chirazonarhid? If you can't answer this one I win

[–] 0 pt

chirazonarhid You got me. I understand Chiromantis as being a genus but do not know what a chirazonarhid is? Please tell me?