WelcomeUser Guide
ToSPrivacyCanary
DonateBugsLicense

©2025 Poal.co

883

Guy does the bare minimum, has an answer for everything, and has the easiest job in the world if he just did it. Prior to covid he had one medical "vacation" per year. 2019 was heart problems, 2020 was gastro problems (Just prior to covid lockdown), 2020 Covid 1 and 2, 2021 is Covid 3. He is a chain smoker and overweight. He was hospitalized in 2019 (heart) & 2020 (gastro and then covid 1) but covid 2 and 3 never in hospital. The kicker...anti-vaxxer.

I wish I was making this shit up but I'm not.

What say the poalers?

EDIT 1: grammar

EDIT 2: he's mid 40s

EDIT 3: Fixed the years the bastard had covid. He really pissed me off today with his laziness and lying in a meeting I called him out for. Why his boss won't fire his ass is beyond me.

Guy does the bare minimum, has an answer for everything, and has the easiest job in the world if he just did it. Prior to covid he had one medical "vacation" per year. 2019 was heart problems, 2020 was gastro problems (Just prior to covid lockdown), 2020 Covid 1 and 2, 2021 is Covid 3. He is a chain smoker and overweight. He was hospitalized in 2019 (heart) & 2020 (gastro and then covid 1) but covid 2 and 3 never in hospital. The kicker...anti-vaxxer. I wish I was making this shit up but I'm not. What say the poalers? EDIT 1: grammar EDIT 2: he's mid 40s EDIT 3: Fixed the years the bastard had covid. He really pissed me off today with his laziness and lying in a meeting I called him out for. Why his boss won't fire his ass is beyond me.

(post is archived)

[–] 5 pts

This comment is fake and gay.

[–] 3 pts (edited )

Joined last year 2 posts

Talking about fake and gay

Comeback here faggot

And debunk this you shitass clown

The new Novel Coronavirus Growing in Culture - HKUMed https://www.youtube.com/watch?v=aOZvf5NOFHs

SARS-CoV-2 infection triggers cell fusion and syncytia formation https://www.youtube.com/watch?v=lB5LZjyi2_k

U2OS-ACE2+ GFP-Split cells were infected with SARS-CoV-2. they turn GFP+ when they fuse together. The time scale is indicated. NI: non infected cells. IFITM1 inhibits cell fusion.

There the fucking genome https://pic8.co/sh/kKRrOC.jpeg

« Human bronchial cells infected by SARS-CoV-2. Scanning electron microscopy. Cells are pseudocolored in blue and virus in orange » (c) Institut Pasteur. Image par Rémy Robinot, Mathieu Hubert, Vincent Michel, Olivier Schwartz & Lisa Chakrabarti, colors by Jean Marc Panaud [1920x1536 - 585KB] https://u.smutty.horse/mczrhbfpwjp.jpeg

sauce https://research.pasteur.fr/en/team/virus-and-immunity/

https://www.pasteur.fr/en/home/press-area/press-documents/operation-and-reliability-rt-pcr-tests-detection-sars-cov-2

What is an RT-PCR test? RT-PCR tests used to detect pathogens, including the test developed by the National Reference Center for Respiratory Viruses at the Institut Pasteur to detect the SARS-CoV-2 genome, are based on the polymerase chain reaction (PCR).

In this method, a small target sequence of nucleic acids (a DNA fragment) is copied multiple times, which facilitates its detection. When this amplification is detected (using a fluorophore-labeled probe), the test is said to be positive.

The short sequence of nucleic acids corresponds to a minute part of the genome of an organism or microorganism. The aim of a PCR test is to detect this sequence so that it can be confirmed whether the sample contains any DNA/RNA of the organism or microorganism. In detection tests aimed at confirming or ruling out infection with a virus or bacteria, the presence of nucleic acids from the pathogen indicates that the subject is infected.

The CNR has developed two RT-PCR tests, known respectively as IP2 and IP4, for the COVID-19 epidemic. These tests each use three separate sequences from the SARS-CoV-2 genome: two "primer" sequences to amplify a short sequence of the viral genome, and a "probe" sequence, which enables detection of the virus by binding to the sequences that have been amplified by the two primers. The genetic material in the sample must correspond with all three sequences simultaneously for the result to be positive. If one of the sequences does not bind, no signal is detected and the result is negative.

The three sequences used in the IP2 test are:

  • CTCCCTTTGTTGTGTTGT and ATGAGCTTAGTCCTGTTG, which have 18 and 17 nucleotides respectively (these are the two primer sequences)
  • and the sequence AGATGTCTTGTGCTGCCGGTA [5']Hex [3']BHQ-1, which has 21 nucleotides (this is the probe sequence).

The whole genome of SARS-CoV-2 consists of a chain of 30,000 base pairs (the human genome has 3 billion base pairs). Since genetic code has just four bases (A, T, C and G), some small nucleotide sequences can be found in several different organisms. This is the case for the sequence CTCCCTTTGTTGTGTTGT, for example, which is found in the genome of humans and also other animal species such as Labrador Retrievers, cats and pigs.

But the association of the three sequences is unique to SARS-CoV-2, and it is this which enables the virus to be identified in tests.

Reliability of the RT-PCR test To guarantee the performance of the test under development, scientists employed a system able to detect whether the three sequences used to recognize SARS-CoV-2 were present in other living organisms. With regard to the RT-PCR tests developed by the National Reference Center, the three sequences are not present simultaneously in any other organisms apart from SARS-CoV-2.

The test is then validated on primary samples (confirmed as positive and negative) to verify its specificity and sensitivity (no false positives or false negatives). Negative controls (here for example nose or throat samples taken before 2019) can help assess the risk of non-specific amplification.

Finally, it is advisable to use two different tests (the two tests developed by the CNR at the Institut Pasteur are named IP2 and IP4) on the same sample to guarantee the reliability of the result. This means that six sequences of the viral genome, rather than three, need to be recognized and amplified, thereby increasing the reliability of RT-PCR testing.

[–] 0 pt

No.. The sequences are NOT unique to covid.. The same sequences are in influenza ..thpe i cant say cuz i misplaced the testing protocol sheet that describes it. Wull update when i find it

[–] 0 pt

Fake and gay. Can't believe you fall for that crap.

[–] 1 pt

Stay in denial, and come back when you actually can demonstrate all the above as false

https://www.dictionary.com/browse/demonstrate

verb (used with object), dem·on·strat·ed, dem·on·strat·ing. to make evident or establish by arguments or reasoning; prove: to demonstrate a philosophical principle. to describe, explain, or illustrate by examples, specimens, experiments, or the like: to demonstrate the force of gravity by dropping an object.

...

As long as you can't, you're a joke

It's that simple

[–] 0 pt

How the hell do you have time to make such thorough comments when most of the people around here are just going to ignore it and insult you with childish insults that clearly don't apply to you ("nigger, kike, faggot, glowie, fed, etc.")

[–] 2 pts

It's mostly a copy pasta of what I already gathered over time poal.co/comment/search/pasteur.fr

[–] 0 pt

Low effort Jew nigger comment