WelcomeUser Guide
ToSPrivacyCanary
DonateBugsLicense

©2026 Poal.co

1.4K

(post is archived)

[–] 6 pts (edited )

amazing paper find.

Big Boy Review Time

This was a PREPRINT from 2020 December (December 13, 2020) prior to peer review. Yes it is that old.

https://files.catbox.moe/mg9m18.pdf

The world now conclusively knows their PCR tests they used was erroneously set to Influenza in this paper. CDC even admitted that FACT 2 weeks ago online.

If they did use real SARS-2 sample, however impure, they did show extremely slight viral insertion into DNA, which means it can be immortalized into Human egg cell or sperm cells and become part of every cell of newborn human. Like Viruses for 1,000,000 years inside human DNA, all broken, fragmented, inert, and incapable of escape (hopefully). All mammals have old virus trapped inside your DNA when born, and one day it might be scary as its an "anchor" a second CRISPR-Cas9 virus could piggyback on to melt a human in 40 minutes from "lysing" a whole being one day.

Mammals Carry a Graveyard of Viruses in Our DNA, And It Could Have a Crucial Purpose: https://www.msn.com/en-au/news/techandscience/mammals-carry-a-graveyard-of-viruses-in-our-dna-and-it-could-have-a-crucial-purpose/ar-AAOli2T

Viruses rarely invade egg cells but as you can see in that link, we know it happens sometimes.

MY SUMMARY

Using amped-up PCR using NOW FRAUDULENT PCR primer source from WHO (Influenza-A and B), this paper got a hyperactive immortal tumor kidney cell from female fetus in 1973 to show SLIGHT viral recombination.

They do however claim 600% higher measurement of "glowing" than control for this claim :

We conducted single-molecule RNA-FISH (smRNA-FISH) using fluorophore-labeled oligo-nucleotide probes targeting N (Fig. 2a) to confirm that viral N sequences were integrated and detected their transcription in the nucleus. SARS-CoV-2 infected cells showed the expected cytoplasmic FISH signals of N RNA (Fig. S3a).

Keep in mind the length of piece they injected was laughably short and common to many virus species : here it is in full "GACCCCAAAATCAGCGAAAT"

yup! Thats how many base pairs they inserted and say its reverse of : "TCTGGTTACTGCCAGTTGAATCTG"

A statistician might roll their eyes at that, but they do claim 600% more presence over background control noise, but I bet DNA has methods of shedding some garbage like that, or neutering it by palindromic gibberish fold backs, or blasting it with base pair mutations, or losing it in 'recombination in meiosis' and preferring other side strand gene, or by affixing inhibiting histone body onto the viral interloper to restrict its ability to create proteins. All of my claims are just uplifting wishful thinking, but I'll be fucking damned if I believe evolution has no defense from tiny trivial sequence "GACCCCAAAATCAGCGAAAT" invading human dna and getting free reign that easily!

So in summary, the already very short single strand SARS-2 virus CANNOT lyse out nor be formed from copies entombed into DNA, but SMALL pernicious common Virus parts ARE slightly sometimes in VERY SMALL FRAGMENTS inserted into DNA of cells and reproduced, and one day shed from apoptosis (normal cell death).

This article, if rewritten, would have to use the new Post Dec 21st 2021 CDC Isolate of SARS-2, would have to also use three PCR test references to eliminate Influenza-A and Influenza-B. HIV is expected too as it has 4 copies on the tiny short SARS-2 Wuhan man-made bioweapon research virus. 4 copies!!!

I propose they had contamination of Influenza-A and B that they tagged and inserted and measured back, and they ADMITTED they only got tiny fragment pieces inserted into human DNA... and very very abnormal IMMORTAL DNA with provably 100s of anomalies since 1973.

This paper is trying to explain why 94% of humans now in 2021 show ANTIBODIES for SARS-2 and PCR results for SARS-2. In Dec 2020 it would have been 45% of westerners.

We now know the answer is proven that though SARS-2 is real (in a computer file) and was real though a shitty virus (in Wuhan), the vast majority of SARS-2 so-called positive people are now proven to be merely survivors of Influenza of unknown prior seasons.

TL/DR: It is alarming that their test sample could measurably (above noise error rate) invade a highly abnormal human cell line, but in this old paper they did not eliminate Influenza , did not get more than a broken tiny piece inserted, did not use proper real SARS-2 isolate, did not use current August 2021 rules for PCR of SARS-2 lines.

[–] 0 pt

Graveyard of viruses? Death? DNA mutations?

All of that sounds like the makings of a zombie outbreak.

[–] 0 pt

but SMALL pernicious common Virus parts ARE slightly sometimes in VERY SMALL FRAGMENTS inserted into DNA of cells and reproduced, and one day shed from apoptosis (normal cell death).

Is this the value alluded to in that graveyard paper? That these old virus fragments would be shed sometimes and then act as (RNA) vaccines, taken into cells and run through the RNA interpreter to make proteins?

Fascinating stuff, thanks for the elaboration and links.

[–] 1 pt (edited )

Is this the value alluded to in that graveyard paper

Living, non-dead cells do not shed fragments of their DNA, though I was cavalier above in one invocation of the word "shed" I meant "shed of its effect and shed of its abilites during cell division"

The value in that paper is using mathematical logic : If a virus got trapped on a sperm or egg cell 10 million years ago, and is still mostly identifiable and not gone after 10 million years, that lucky virus fragment IS BENEFICIAL TO THE HOST.

Benefits are subtle because its too damaged to be a virus, or to even be a protein, its just a form of mystery junk, but helpful by REGULATING ADJACENT genes nearby, similar to UV sunburn palindrome repeats. Either slowing down formation, or aiding in formation of protein creation.

But these ancient fragments , if free fragments, only show up in DEAD and SHED ruptured cells shit out, sweat out, coughed out, shed out, and then under ridiculous amplification under PCR spotted in a PCR test.

I do not think ANY coronavirus , especially not SARS-2 is meant to enter human DNA, or does enter human DNA. Its too primitive and simple a virus, and it cannot even on its own rupture a cell. Its basically very clever lucky primitive little thing that itself uses 3d shape folding odds to accidentally make three lengths of its own virus DNA. But.... but... these researchers were responding to similar old papers amazed that sars-2 was detected in cured patients months later in thier blood :
SARS-CoV-2 RNA detected in blood products from patients with COVID-19 is not associated with infectious virus https://pubmed.ncbi.nlm.nih.gov/33283055/

All those old paper were written

1-- BEFORE SARS-2 pure sample isolate announced by CDC the third week of December 2020 on the CDC web site

2 -- BEFORE CDC admitted 2 weeks ago that all PCR tests prior to Sept 2021 are errant and false and MOST LIKELY Influenza-A and Influenza-B, and that the testing data from CDC was errant

So ... occam's razor ? It was always just the flu (a different virus species) except for small percentage of unfortunate people near wuhan

[–] 0 pt

So the part about the sequences being preserved for so long over evolutionary history is because something about the fragments happened to be useful for regulating genes, not because they still get interpreted to make parts of the virus they were from (to help the immune system learn it)?

And otherwise basically these researchers are thrown off by the PCR test, thinking it's detecting the entire virus when it's just detecting small fragments not coming from human DNA.

[–] 0 pt

What this also means then is evolution of a species could be largely triggered by viral infections as well as random DNA misconnections that were always assumed.

[–] 0 pt

This would mean that coronaviruses are able to insert genes into cells like adenoviruses do. I'm skeptical, but nothing is impossible. Another reason for treating C19 patients with ivermectin: Ivermectin blocks the virus from sending proteins into the nucleus to change gene expression. If the nucleus is protected, no RNA can integrate.

[–] 2 pts

ivermectin

Its primary effect is probably by drawing more zinc ions into cell and thus like HCQ deforming the specially fragile SARS-2 coronavirus in one of its odds of creating its longest protein... itself.

But THIS PAPER says Ivermectin is a wonderdrug with THREE , YES THREE effects, one outside cell, one intra-cell, and one , AS YOU STATED, protecting nucleus DNA :

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8203399/

diagram of 'the RED Xs' from Ivermectin : https://files.catbox.moe/cmsoec.png

It actually lists far more than three mechanisms and mentions "Level 3: Action as an Ionophore" but maliciously does not name zinc by name.

[–] 1 pt

I think that blocking the importer molecules is the by far most important effect of ivermectin because the virus has no chance if it cannot block the gene expression needed to produce the self-defence stuff.

Ivermectin also plays a role in regulating the immune-response, avoiding or dampen the cytokine storm. This is why ivermectin also helps in the ICU, when the virus load is already going down.

[–] 0 pt

To experimentally corroborate the possibility of viral retro-integration, we describe evidence that SARS-CoV-2 RNAs can be reverse transcribed in human cells by reverse transcriptase (RT) from LINE-1 elements or by HIV-1 RT, and that these DNA sequences can be integrated into the cell genome and subsequently be transcribed.

Wait. Wut?