WelcomeUser Guide
ToSPrivacyCanary
DonateBugsLicense

©2026 Poal.co

1.4K

source: https://www.technocracy.news/dr-michael-yeadon-not-one-of-those-things-is-supported-by-the-science/

Author: Michael Yeadon, Ph.D., a life science researcher and former vice-president and chief scientist of allergy and respiratory research at Pfizer

“Viruses are really tiny, and their business is to get as quickly as they can inside your cells. So, they bind to a receptor on the surface and inject themselves into your cell. So, they’re inside. Antibodies are big molecules and they’re generally outside your cells.

So just think about that for a moment. Antibodies and viruses are in separate compartments. The virus is inside the cell, the antibodies outside the cell. I’m not saying antibodies have no role, but they’re really not very important. This has been proven. There are some people in whom a natural experiment has occurred.

They have a defect and they actually don’t make antibodies, but they’re able to fight off COVID-19, the virus SARS-CoV-2, quite well. The way they do that is, they have T-cell immunity, cellular immunity. [T-cells] are cells that are trained to detect virus-infected cells and to kill those cells. That’s how you defend yourself against a virus.

So, all of these mentions of antibody levels, it’s just bunk. It is not a good measure of whether or not you’re immune. It does give evidence that you’ve been infected, but their persistence is not important as to whether you’ve got immunity …

We’ve known this for decades. We’ve known about T-cells for decades. They were clearly in my undergraduate textbooks. And we’ve known about their importance in defending you against respiratory viruses since probably the 1970s, certainly the 1980s. So, don’t believe anything where people suggest to you that their role is uncertain. We’ve known for a very long time that they are absolutely central.”

source: https://www.technocracy.news/dr-michael-yeadon-not-one-of-those-things-is-supported-by-the-science/ Author: Michael Yeadon, Ph.D., a life science researcher and former vice-president and chief scientist of allergy and respiratory research at Pfizer >“Viruses are really tiny, and their business is to get as quickly as they can inside your cells. So, they bind to a receptor on the surface and inject themselves into your cell. So, they’re inside. Antibodies are big molecules and they’re generally outside your cells. > So just think about that for a moment. Antibodies and viruses are in separate compartments. The virus is inside the cell, the antibodies outside the cell. I’m not saying antibodies have no role, but they’re really not very important. This has been proven. There are some people in whom a natural experiment has occurred. > They have a defect and they actually don’t make antibodies, but they’re able to fight off COVID-19, the virus SARS-CoV-2, quite well. The way they do that is, they have T-cell immunity, cellular immunity. [T-cells] are cells that are trained to detect virus-infected cells and to kill those cells. That’s how you defend yourself against a virus. > So, all of these mentions of antibody levels, it’s just bunk. It is not a good measure of whether or not you’re immune. It does give evidence that you’ve been infected, but their persistence is not important as to whether you’ve got immunity … > We’ve known this for decades. We’ve known about T-cells for decades. They were clearly in my undergraduate textbooks. And we’ve known about their importance in defending you against respiratory viruses since probably the 1970s, certainly the 1980s. So, don’t believe anything where people suggest to you that their role is uncertain. We’ve known for a very long time that they are absolutely central.”

(post is archived)

[–] 1 pt

When you understand where the virus attacks you and what it's interrupting it kind of makes sense, and if this was genetically engineered, they wanted this to be quite nasty. Luckily for us they're fucking morons.

[–] 2 pts

So either it escaped wuhan before it was ready for prime time -or- an intentionally less deadly variant was used to frame CCP. Seems obvious.

[–] 1 pt

Nope. There is one reference genome. One. Provided by Wuhan. No one else has been able to sequence a SARS COV 2 genome. Why? Because they digitally mocked up a chimera in order to trigger as many false positives as possible.

WTF do I mean?

When you need to sequence a genome, you have to blow apart many cells many times and reverse engineer the correct order. The way to do this is to line up the first for or 5 nucleotides. So, say you have a 24 nucleotide sequence; they are only looking at the first and last 5 nucleotides to make a match.

Let's say you get some of your thousands and thousands of pieces isolated. They will look like this...

  1. CAGUAGCUAGAUACGAUAGCAUUAGC

  2. ACGUACGUACGUACGUACGUGAUC

  3. ACGUGAUCGAUCGAUCGAUCACGU

  4. GAUCGAUCGAUCGAUCGAUCCAGU

Your reference genome is going to be thousands of characters. I won't bother demonstrating.

You can see how 1 and 4 have ends that overlap and, with enough data, enough cells and cell fragments, we can reliably figure out the right order. With too little data, we can say anything we want.

But imagine if some digitally mocked up a genome made up of as many pairings as possible to allow for the highest statistical probability of showing positive.

The genome sequencing, if you were to ask for it, would result in them exp,doing a sample of your infected cells, then subtract out everything they don't want to see... influenza, rhinovirus... whatever. So, even if you have these things, they are eliminated because the sequencer is using the reference genome provided by Wuhan and subtracting all potentially irrelevant data.

The sequencing only looks for segments that match the reference genome.

The BLAST database houses all this data. You can go check for yourself.

While the CDC touts 280k samples have been sequenced, the longest chain I found (after looking through them one by one for a couple of hours) was a 14 nucleotide chain. Most of the submissions were from 30 to 40 random segments of merely small pairs.

This data is so f***ing fake.

You can purportedly order SARS COV 2 for laboratory testing. I have yet to see anyone sequence a full genome beyond what Wuhan provided, but they are clinging to this shit like saran wrap.

Further proof exists in the bullshit testing. Antigen, antibody and PCR tests all show as positive for every coronavirus strain. Surprise... all human affecting coronaviruses have the S spike protein and the body responds to its presence by adding a CR3022 protein into the polyproteij chain that makes up white blood cells.

CR3022 blocks S spike protein from attaching to your cells. Why make an RNA vaccine when inactive S spikes (like every other previous vaccine and like the vaccines China made for their people) will cause the body to make CR3022?

Think about that. We can make a vaccine that is simple, old fashioned and causes the same result. Why in the fuck do we need to inject RNA when the Chinese already had a vaccine ready without it, when everyone already knew about S spike proteins and CR3022?

How is it that two totally different types of vaccines were ready to go? How is it that, all over the world, Russia, America, China and many others miraculously found the cure immediately and at almost exactly the same time?

[–] 1 pt (edited )

http://www.youtube.com/watch?v=Y2QNnoqc3XU

Is the scene from a 2020 movie(edit Tv show, Utopia remake)(clearly predictive programming giving the circumstances right now)

You clearly know more about infections then I do, but I'm very good at sniffing out things...I'll try to offer a hint that you could perhapse elaborate on given your field of study or just being smart at that particular subject

As I understand it (forgive laymens terms) the S spike protein is VERY similar in "shape" i guess you'd say, to a protein that either is fully, or largely responsible, for the adhering of the placental tissue to the uteran(sp) wall. This "vaccine" will cause women's bodies to identify any protein closely resembling the spike protein in "covid" and cause the body to attack it.

What i suspect is that there is no actual corona, and this "spike protein" is pushed as the "solution" of infection because of it's closely resembelling the placental protein. This will allow them to, once infertility starts becoming openly noticed, say "Oh, look at that, a side effect of the vaccine, ah darn, we didn't know" or something along those lines...I doubt whoever had a hand in this doesn't have some sort of plan where they stay in power despite what they just did.

So basically I think they are using the cover of a fake epidemic to get people to rush out and beg to be sterilized (reality)

but instead they think they are rushing out to do their part to protect humanity

it's like...satan himself is running a bait and switch operation...