WelcomeUser Guide
ToSPrivacyCanary
DonateBugsLicense

©2025 Poal.co

980

Link to study: https://www.sciencedirect.com/science/article/pii/S0166354220302011

Background to story: https://www.smh.com.au/national/how-an-australian-covid-cure-conquered-the-world-despite-no-robust-evidence-it-works-20201106-p56c7m.html

I'm thinking just vote her as Scientist of the Year in all the polls all over the world.

She's female, so some feminist angle shit

She's chunky, so body positivity.

She's a scientist, so she could be an inspiration to kids for some STEM angle shit.

Ivermectin has to have a human face and a story behind it. I think she will fit the bill nicely.

Link to study: https://www.sciencedirect.com/science/article/pii/S0166354220302011 Background to story: https://www.smh.com.au/national/how-an-australian-covid-cure-conquered-the-world-despite-no-robust-evidence-it-works-20201106-p56c7m.html I'm thinking just vote her as Scientist of the Year in all the polls all over the world. She's female, so some feminist angle shit She's chunky, so body positivity. She's a scientist, so she could be an inspiration to kids for some STEM angle shit. Ivermectin has to have a human face and a story behind it. I think she will fit the bill nicely.

(post is archived)

[–] 0 pt

The sequences that have been published do not belong – as claimed- to a new virus. Carry out a search with a computer program called Basic Local Alignment Search Tool or BLAST. It is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. 

The sequences of SARS-CoV-2 are found in both humans and numerous microbes. The E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472: ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA shares the same sequence with over 100 microbes and 10 human genome sequences. The same can be said for much of the S gene said to generate the structural spike along with numerous other sequences leading one to question the purity of this isolate and how much of this truly reveals a unique virus.

To date, not one of the 7 human coronaviruses has truly been isolated.