The sequences that have been published do not belong – as claimed- to a new virus. Carry out a search with a computer program called Basic Local Alignment Search Tool or BLAST. It is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi.
The sequences of SARS-CoV-2 are found in both humans and numerous microbes. The E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472: ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA shares the same sequence with over 100 microbes and 10 human genome sequences. The same can be said for much of the S gene said to generate the structural spike along with numerous other sequences leading one to question the purity of this isolate and how much of this truly reveals a unique virus.
To date, not one of the 7 human coronaviruses has truly been isolated.
(post is archived)